International Journal of Oral and Craniofacial Science
Department of Pedodontics and Preventive Dentistry, Manu bhai Patel Dental College, Near Vishwajoti Ashram, Munjmahuda, Vadodara, Gujarat, India
Cite this as
Soni H, Vasavada M (2015) Distribution of S. mutans and S. sorbinus in Caries Active and Caries Free Children by PCR Approach. Int J Oral Craniofac Sci. 2015; 1(1): 27-30. Available from: 10.17352/2455-4634.000005
Copyright License
© 2015 Soni H, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.Background: Streptococcus mutans (S. mutans) and Streptococcus sorbinus (S. sorbinus) have been considered to be the most important micro-organisms associated with dental caries. Therefore, purpose of this study is to detect and correlate the presence of S. mutans and S. sobrinus in the dental plaque of caries free and caries active children, by using Polymerase chain reaction (PCR) method.
Materials and Methods: Twenty patients aged between ages 4-8 years were included in the study. The subjects were divided in two groups: Group A consisting of ten children with early childhood caries and Group B consisting of ten caries-free children. Dental examinations were performed using a plane dental mirror and explorer. Plaque sample was collected from the cervical margin of the teeth by using explorer. PCR testing was performed for S. mutans and S. sorbinus. The data was analyzed by using SPSS software. The caries score data was analyzed among groups by applying Fischer’s exact test. The P value <0.05 was considered as significant.
Results: S. mutans was present in all patients, whether they were caries active or caries free. There was no statistically significant difference in the presence of S. sorbinus in caries active patients as compared to caries free patients. It was also noticed that S. sorbinus was found more in male patients as compared to females, the difference being statistically non-significant.
Conclusion: Children harbouring both S. mutans and S. sorbinus had a higher incidence of dental caries as compared to the presence of either organism alone.
Dental caries is one of the most common chronic infectious disease of childhood, caused by the interaction of bacteria, mainly Streptococcus mutans, and sugary foods on tooth enamel. These bacteria break down sugars for energy, causing an acidic environment in the mouth and result in demineralization of the enamel of the teeth and dental caries [1]. Dental caries in infants and toddlers is now collectively known as Early childhood caries (ECC). Early childhood caries results in a considerable direct burden of pain and suffering as well as poorer general health of the children. Despite efforts in restorative therapy, children who experience ECC continue to be at higher risk for new lesions in both the primary and the permanent dentition [2]. Understanding the role of specific bacterial species and subspecies is important for creating a complete model of caries aetiology.
There are three major hypothesis for the aetiology of dental caries: the specific plaque hypothesis, the nonspecific plaque hypothesis and the ecological plaque hypothesis [3]-[5]. The specific plaque hypothesis has proposed that only a few specific species, such as Streptococcus mutans (S. mutans) and Streptococcus sorbinus (S. sorbinus), are actively involved in the disease. According to the nonspecific plaque hypothesis, dental caries is the outcome of the overall activity of the total plaque micro flora, which is comprised of many bacterial species. The ecological plaque hypothesis suggests that caries is a result of a shift in the balance of the resident micro flora driven by changes in local environmental conditions [4].
Among the oral bacteria, Mutans streptococci have been implicated as a major cariogenic bacteria. The degree of colonization of these organisms correlates with the prevalence of dental caries in children and experimental animals.
Mutans streptococci is divided into seven species: Streptococcus mutans, Streptococcus sobrinus, Streptococcus downei, Streptococcus rattus, Streptococcus cricetus, Streptococcus ferus, and Streptococcus macacae. Among these S. mutans and S. sobrinus are strongly associated with human dental caries [6]. Epidemiological studies have reported that S. mutans is more prevalent than S. sorbinus in the oral cavity, but have also shown that the prevalence of S. sorbinus is more closely associated with a high caries experience [7].
Molecular methods for bacterial identification and enumeration now make it more precise to study the microbiota associated with caries. DNA sequence-based assays can be used to identify closely related species that are difficult to differentiate by traditional, culture-based approaches [8]. Various methods have been used for detection, including biochemical tests, immunological tests, DNA probes, and Polymerase Chain Reaction (PCR). Among these, the PCR method is currently being applied to the detection of putative pathogens and the identification of human cariogenic bacteria because it is rapid, sensitive, and simple.
The purpose of this study is to detect and correlate the presence of S. mutans and S. sobrinus in the dental plaque of caries free and caries active pre-school children, by using PCR method.
The present study was conducted in the Department of Pedodontics and Preventive Dentistry at Manu bhai Patel Dental College, Vadodara.
Ethical clearance was taken from the University Ethical Committee before conducting the study. Full detailed treatment and benefits were explained to the parents of the children and written informed consent for the treatment was taken from the parent/guardian prior to participation of subjects in the study.
Twenty patients aged between ages 4-8 years were included in the study. The subjects were divided in two groups: Group A consisting of ten children (five males and five females) with early childhood caries and Group B (five males and five females) consisting of ten caries-free children. The following patients were included in the study: (I) Children having more than 6 carious lesions were included in the study for Group A. The World Health Organization (WHO) caries diagnostic criteria was used for determining the dmft (decayed, missing, filled) index. (II) Children having no existing caries were included for Group B. Patients who had any of the following criteria were excluded from the study: (I) Children who were on antibiotics within the past 3 months (II) Children with any systemic diseases were excluded from the study (III) Children with existing restorations on any surface of tooth were excluded from the study and (IV) Medically compromised children.
Dental examinations were performed using a plane dental mirror and explorer. Plaque sample was collected from the cervical margin of the teeth by using explorer. Each explorer was immediately placed in a tube containing sterile pH 7.0 phosphated-buffered saline, and frozen immediately at -20°C.
DNA extraction from samples was performed using Merc DNA Saliva Extraction Kit according to the manufacturer's instructions: Plaque samples were first harvested by centrifugation at 1600 g for 20 min. The supernate were discarded and individual cell pellets were stored at -20°C until DNA isolation. The genomic DNA preparation from each plaque sample was obtained by a standard miniprep procedure, with the addition of an RNA ase treatment. PCR testing and amplification was performed as previously reported for: S. mutans and S. sorbinus. PCR amplification was performed in a reaction mixture (25 µl) consisting of PCR beads that contained an enzyme and the required reagents, 25 pmol of each primer and 20–50 ng of the template DNA solution in a thermal cycler. The reaction mixture was denatured at 95°C for 3 min followed by a series of amplifications: denaturation at 95°C for 1 min, annealing at 55°C for 1 min and extension at 72°C for 1 min. The series was repeated for 26 cycles. The final cycle comprised 94°C for 1 min, 55°C for 1 min and 72°C for 5 min. After amplification, 15 µl of the PCR products were analyzed by electrophoresis on an agarose 1.2% gel. The newly synthesized DNA fragments were visualized under ultraviolet light at 302 nm after staining with ethidium bromide. The size of the PCR products was estimated from the electrophoretic migration of products relative to a 100-bp ladder. The data was analyzed by using SPSS. The caries score data was analyzed among groups by applying Fischer's exact test. The P value <0.05 was considered as significant.
Table 1 shows the age and dmft values of the children included in the study.
Table 2 shows the distribution of various organisms between children according to their caries status. S. mutans was present in 100% of the subjects. S. sorbinus was present in increased number in the caries active group than the caries free group but the difference was not significant.
The Fischer's test values for the distribution of micro-organisms between children who were caries active and caries free was 0.45, which was not significant.
Dental caries is an infectious disease in which members of the Mutans streptococci have been implicated as the etiological agents. Thereby, this study was undertaken to understand the association of S. mutans and S. sorbinus to the presence of dental caries in children. In the present study, dental plaque was used as a source for detection of cariogenic bacteria rather than bacteria from saliva. As the intention is to relate the presence of cariogenic bacteria and dental caries, using saliva as a source of the bacteria does not permit establishing an effective association. Although the presence of S. mutans is high in saliva, it is lower on the surface of enamel, where the bacteria actually manifests its capacity to produce acids leading to subsequent demineralization [9].
In this study, supra gingival plaque samples were collected from the cervical margins of both caries and caries free tooth surfaces with the help of a sterile dental explorer. Various authors as Carmona et al. [9], Choi et al. [10] and Okada et al. [11], in their respective studies collected supra gingival plaque samples with the dental explorer for the detection of S. mutans and S. sobrinus from children without caries, with early childhood caries and severe early childhood caries.
The detection and identification of oral streptococci in the dental biofilm is considered to be an important step for the understanding of dental caries. Nearly all investigations into the microbial pathogenesis have been done by cultivation of bacteria. This conventional method of culturing the bacteria is more time consuming and is sometimes, inaccurate. It has also been reported that MS-bacitracin inhibits the growth of S. sorbinus to a greater extent than that of S. mutans on the agar medium, thereby providing inappropriate results [8]. However, the advanced molecular methods have revealed that the bacterial involvement in the development of dental caries is more complex than previously believed in the present study, PCR method was used for amplification of the gene sequences of S. mutans and S. sobrinus. According to Igarashi et al. [12], PCR is a rapid, more sensitive and simpler method for the detection of micro-organisms. They also reported that the conventional cultural methods used for the detection of micro-organisms in dental plaque takes a long time, nearly 1 week whereas PCR method reduces the time to 6-7 hours. PCR was used in a number of studies to detect micro-organisms and to evaluate their association with dental caries [13]-[16].
PCR technique requires the use of primers for specific organisms. Primers are short pieces of single-stranded DNA that are complementary to the target sequence. In our study, oligonucleotide primers used were GTFB- F5'- ACTACACTTTCGGGTGGCTTGG and GTFB- R5'- CAGTATAAGCGCCAGTTTCATC, designed to amplify a 517 bp (base pair)-DNA fragment of the gtf B gene sequence of Streptococcus mutans, and GTFI- F5'- GATAACTACCTGACAGCTGACT and GTFI- R5'- AAGCTGCCTTAAGGTAATCACT, designed to amplify a 712 bp (base pair)-DNA fragment of the gtf I gene sequence of Streptococcus sobrinus. The gtfB and gtfI genes of Streptococcus mutans and Streptococcus sobrinus respectively are suitable for designing PCR primers, as both genes express important virulence factors of the cariogenic bacteria and have nucleotide sequences specific to each species [17]. The same set of primers were used for the detection of S. mutans and S. sobrinus in studies done by Carmona et al. [8], Seki et al. [18] and Franco e Franco et al. [19] and they yielded substantial results.
In our study, the results showed that both S. mutans and S. sobrinus were present in 60% of caries active samples and 30% of caries free samples, which was almost double in caries active samples as compared to caries free samples. Similar results were seen in studies indicating the likelihood of the presence of both mutans streptococci to be three times more in caries active group as compared to caries free group [10,14],[20].
In the present study, S. mutans was detected in all subjects, whether they were caries active or caries free. A study by Rodriguez et al. [21], on Mexican preschool children, showed the percentage of S. mutans isolation was 75% in caries active children and 60% in caries free children and another study by Choi et al. [10] also showed that S. mutans was detected 100% in children with dental caries and 80% in children without dental caries. Both these studies showed no statistically significant difference the studies conducted by Loesche and Straffon. [22] and Aas et al. [23], demonstrated that caries can occur in the absence of S. mutans. The results of these studies had similar results in which mutans was associated with both caries active and caries free children, contradicting its role in the initiation and progression of caries [24]-26] In contrast, Carmona et al. [9], found that the frequency of S. mutans was 76% in subjects with caries and 24% in subjects without caries showing a statistically significant difference. Ge et al. [27], demonstrated that ECC is associated not only with increased levels of S. mutans but also due to elevated levels total streptococci in the mouth. S. mutans is a dominating species, widespread in populations with low caries prevalence, indicating that the ecological determinants of these bacteria are not necessarily associated with a caries promoting lifestyle [28]. Matee et al. [24] and Sullivan et al. [25], observed that the level of oral streptococci in the saliva of children cannot predict future caries. The importance of S. mutans in caries etiology has been well documented, but the growing recognition that the cariogenic potential may be determined by complex interactions in dental plaque biofilm rather than solely the virulence properties of a single organism [29] hence, there was no clear relationship between caries experience and the presence of S. mutans.
The present study also showed that S. Sobrinus was present in 60% of caries active group whereas 30% was present in caries free group and the difference was statistically significant. Carmona et al. [9], in their study reported that the frequency of S. Sobrinus was 81.9% in carious lesions and 18.1% in caries free surfaces with the difference being statistically significant. Choi et al. [10], showed in their study that S. sobrinus was detected less frequently than S. mutans in caries free children. They reported that S. sobrinus was detected in 43-60% in early childhood caries group and 8.6% of caries free group. Similarly, Rodriguez et al. showed that S. sobrinus was isolated more than twice as high in caries active children as compared with caries free individuals, this suggests that S, sorbinus was associated with active dental caries and children with caries experience [21]. Beighton et al. [30], however found no correlation between the caries experience and the salivary S. sorbinus level. It is important to consider that different strains of Mutans streptococci induce different levels of dental decay in animal models, probably because S. sorbinus produces acid more rapidly than S. mutans [31].
There was a different distribution of mutans streptococci between caries-free and caries-affected children. The presence of S. sorbinus was more closely related to the presence of dental caries in contrast to S. mutans. Children harbouring both S. mutans and S. sorbinus had a higher incidence of dental caries as compared to the presence of either organism alone.
Subscribe to our articles alerts and stay tuned.
This work is licensed under a Creative Commons Attribution 4.0 International License.

If you are already a member of our network and need to keep track of any developments regarding a question you have already submitted, click "take me to my Query."